Marker Details
| Marker Name: | IDP1447 |
| Marker Category: | IDP |
| Marker Type: | Dominant |
| Polymorphism Type: | +/- (B73/Mo17) |
| Map Location: | Chr01 - 7.8 cM (View on CMap) |
Sequences
| Design Source Sequence: | 18175349 |
| Related Sequences (Direct Match): | MAGIv3.1_82205; MAGIv4_141647 |
| Related Sequences (Indirect Match): | MEC_61086_P95-Mar06; MEC_61087_P95-Mar06; MEC_61088_P95-Mar06; MEC_27515_P95-Mar06; MEC_27516_P95-Mar06; MEC_89772_P95-Mar06; 32825132; 50332935; 150058_1930_2632; 158573_0855_0243; 067760_3517_1550; 180069_1021_2458; 236928_3670_2498; 033095_2965_1842; 78085408; 88755358; 76290542; 88750915; 32825305; 76910732; 088001_2990_0419; 13150424; 3157305; 223842_1585_1059; 147983_1904_0760; 258787_1068_3699; 017498_0589_0940; 143706_0173_3747; 233520_1254_3353; 264685_1033_0158; 212323_0833_1706; 281105_1113_3528; 122793_3618_1639; 047745_1365_2819 |
Related Microarray Spots
| Platform | Direct Match | Indirect Match |
| Chip SAM3.0 (GPL3538) | - | A-1-2-1-3 |
| Chip SAM1.2 (GPL4521) | - | A-3-3-15-16 |
| Chip SAM1.1 (GPL3333) | - | A-1-2-18-19 |
Primer Info
| Orientation | Name | Sequence | Length (bp) |
| Forward | M212E1031F | ATTAGTCTGGCGCAATTTGG | 20 |
| Reverse | M212E1031R | ACCACTACGGCACTACCTGC | 20 |
Gradient Test of Primer
| Setup Conditions for 20µl PCR Reaction | PCR Program | ||||||||||||||||||
|
Tm values were calculated by primer3
design software. Details on their implementation can be found here. For a complete list of Tm values for all ISU mapped markers, click here.
|
24-Inbred Survey
- Setup conditions for 20µl PCR reaction: same as described above, use 60°C as Annealing Temperature.
Inbred Scores
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Score Legend
| B73 | Mo17 | I (Other Inbred) | Size | Code |
| + | + | + | B=M=I | 1 |
| + | + | + | B=M, B≠I, M≠I | 2 |
| + | + | + | B≠M≠I | 3 |
| + | + | + | B≠M, B=I, M≠I | 4 |
| + | + | + | B≠M, B≠I, M=I | 5 |
| + | + | - | B=M | 6 |
| + | + | - | B≠M | 7 |
| + | - | - | 8 | |
| + | - | + | B=I | 9 |
| + | - | + | B≠I | 10 |
| - | + | - | 11 | |
| - | + | + | M=I | 12 |
| - | + | + | M≠I | 13 |
| - | - | - | 14 | |
| - | - | + | 15 |
Intermated B73 x Mo17 (IBM) Map
IBM Map Scores
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
IBM Map Legend
| Code | |
| Missing Data or Heterozygous | 0 |
| B73 | 1 |
| Mo17 | 2 |
_01.jpg)
_02.jpg)
_03.jpg)