Marker Details
| Marker Name: | IDP5027 |
| Marker Category: | IDP |
| Marker Type: | Dominant |
| Polymorphism Type: | +/- (B73/Mo17) |
| Map Location: | Chr01 - 23.9 cM (View on CMap) |
Sequences
| Design Source Sequence: | MAGIv3.1_63384 |
| Related Sequences (Direct Match): | MAGIv3.1_63384; MAGIv4_160823 |
| Related Sequences (Indirect Match): | MEC_14464_P95-Mar06; 226743_1652_2273; 78115604; 50337801; 107936_0747_1373; 067475_0032_1612 |
Primer Info
| Orientation | Name | Sequence | Length (bp) |
| Forward | F31b063384P1EF | AAGTTGCTTAGGCTTGCTGC | 20 |
| Reverse | F31b063384P1IR | TCACTGTGAGCTAGGGTTTGG | 21 |
Gradient Test of Primer
| Setup Conditions for 20µl PCR Reaction | PCR Program | ||||||||||||||||||
|
Tm values were calculated by primer3
design software. Details on their implementation can be found here. For a complete list of Tm values for all ISU mapped markers, click here.
|
24-Inbred Survey
- Setup conditions for 20µl PCR reaction: same as described above, use 60°C as Annealing Temperature.
Inbred Scores
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Score Legend
| B73 | Mo17 | I (Other Inbred) | Size | Code |
| + | + | + | B=M=I | 1 |
| + | + | + | B=M, B≠I, M≠I | 2 |
| + | + | + | B≠M≠I | 3 |
| + | + | + | B≠M, B=I, M≠I | 4 |
| + | + | + | B≠M, B≠I, M=I | 5 |
| + | + | - | B=M | 6 |
| + | + | - | B≠M | 7 |
| + | - | - | 8 | |
| + | - | + | B=I | 9 |
| + | - | + | B≠I | 10 |
| - | + | - | 11 | |
| - | + | + | M=I | 12 |
| - | + | + | M≠I | 13 |
| - | - | - | 14 | |
| - | - | + | 15 |
Intermated B73 x Mo17 (IBM) Map
IBM Map Scores
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
IBM Map Legend
| Code | |
| Missing Data or Heterozygous | 0 |
| B73 | 1 |
| Mo17 | 2 |
_01.jpg)
_02.jpg)
_03.jpg)