Marker Details
| Marker Name: | IMR8 |
| Marker Category: | IMR |
| Marker Type: | Dominant |
| Polymorphism Type: | +/- (B73/Mo17) |
| Map Location: | Chr01 - 18.0 cM (View on CMap) |
Sequences
| Design Source Sequence: | MAGIv3.1_62261 |
| Related Sequences (Direct Match): | MAGIv3.1_62261; MAGIv4_37970 |
| Related Sequences (Indirect Match): | 76017308; 156623_3215_0893 |
Primer Info
| Orientation | Name | Sequence | Length (bp) |
| Forward | 31bMAGI_62261L3 | GGGGAGAATAAGGGGACAAA | 20 |
| Reverse | 31bMAGI_62261R3 | TAGCGCTGTGCAGAGACTGT | 20 |
Gradient Test of Primer
| Setup Conditions for 20µl PCR Reaction | PCR Program | ||||||||||||||||||
|
Tm values were calculated by primer3
design software. Details on their implementation can be found here. For a complete list of Tm values for all ISU mapped markers, click here.
|
Intermated B73 x Mo17 (IBM) Map
IBM Map Scores
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
IBM Map Legend
| Code | |
| Missing Data or Heterozygous | 0 |
| B73 | 1 |
| Mo17 | 2 |
_01.jpg)
_02.jpg)
_03.jpg)