Marker Details
| Marker Name: | TIDP3140 |
| Marker Category: | TIDP |
| Marker Type: | Co-Dominant |
| Polymorphism Type: | TGCE |
| Map Location: | Chr01 - 25.0 cM (View on CMap) |
Sequences
| Design Source Sequence: | 5819271 |
| Related Sequences (Direct Match): | MAGIv3.1_112276; MAGIv4_32351 |
| Related Sequences (Indirect Match): | MEC_7826_P95-Mar06; MEC_63403_P95-Mar06; MEC_92096_P95-Mar06; MEC_91890_P95-Mar06; MEC_33780_P95-Mar06; MEC_52417_P95-Mar06; MEC_46702_P95-Mar06; MEC_46701_P95-Mar06; MEC_9811_P95-Mar06; MEC_20712_P95-Mar06; MEC_33204_P95-Mar06; MEC_33211_P95-Mar06; MEC_66589_P95-Mar06; 74234532; 048244_0044_1321; 169743_1743_1038; 082986_3151_1577; 298301_3806_2043; 065489_1335_0471; 175714_2325_2255; 116194_1351_3451; 205954_2182_0121; 050769_0672_0648; 062086_4029_2406; 128262_2407_2731; 107493_1581_2782; 122691_1022_0915; 066332_0069_2692; 064885_1886_2279; 149507_3702_3707; 88749453; 32932025; 88749454; 32825890; 168099_0976_0366; 034051_2562_1423; 216616_3703_0478; 157072_2863_0483; 62525778; 327693_3806_1678; 048528_1581_1929 |
Related Microarray Spots
| Platform | Direct Match | Indirect Match |
| Chip SAM3.0 (GPL3538) | - | A-3-1-19-3 |
| Chip SAM1.2 (GPL4521) | - | A-7-2-20-8 |
| Chip SAM1.1 (GPL3333) | - | A-7-3-15-10 |
Primer Info
| Orientation | Name | Sequence | Length (bp) |
| Forward | Z58192713F | CCAGCCCACACTTTATTTGG | 20 |
| Reverse | Z58192713R | ACGGTCAGATTGACTACGCC | 20 |
Gradient Test of Primer
| Setup Conditions for 20µl PCR Reaction | PCR Program | ||||||||||||||||||
|
Tm values were calculated by primer3
design software. Details on their implementation can be found here. For a complete list of Tm values for all ISU mapped markers, click here.
|
24-Inbred Survey
- Setup conditions for 20µl PCR reaction: same as described above, use 60°C as Annealing Temperature.
Inbred Scores
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Score Legend
| B73 | Mo17 | I (Other Inbred) | Size | Code |
| + | + | + | B=M=I | 1 |
| + | + | + | B=M, B≠I, M≠I | 2 |
| + | + | + | B≠M≠I | 3 |
| + | + | + | B≠M, B=I, M≠I | 4 |
| + | + | + | B≠M, B≠I, M=I | 5 |
| + | + | - | B=M | 6 |
| + | + | - | B≠M | 7 |
| + | - | - | 8 | |
| + | - | + | B=I | 9 |
| + | - | + | B≠I | 10 |
| - | + | - | 11 | |
| - | + | + | M=I | 12 |
| - | + | + | M≠I | 13 |
| - | - | - | 14 | |
| - | - | + | 15 |
Intermated B73 x Mo17 (IBM) Map
IBM Map Scores
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
IBM Map Legend
| Code | |
| Missing Data or Heterozygous | 0 |
| B73 | 1 |
| Mo17 | 2 |
_01.jpg)
_02.jpg)
_03.jpg)