Marker Details
| Marker Name: | TIDP3590 |
| Marker Category: | TIDP |
| Marker Type: | Co-Dominant |
| Polymorphism Type: | TGCE |
| Map Location: | Chr01 - 9.5 cM (View on CMap) |
Sequences
| Design Source Sequence: | 14243663 |
| Related Sequences (Direct Match): | MAGIv3.1_98496; MAGIv4_113206; 18169566; 14243663 |
| Related Sequences (Indirect Match): | MEC_26649_P95-Mar06; MEC_26648_P95-Mar06; MEC_71635_P95-Mar06; MEC_78313_P95-Mar06; MEC_71305_P95-Mar06; MEC_21209_P95-Mar06; MEC_14996_P95-Mar06; MEC_78347_P95-Mar06; MEC_84138_P95-Mar06; MEC_84139_P95-Mar06; MEC_9619_P95-Mar06; 121656_3706_0713; 6020691; 237940_3581_1217; 122720_0546_0789; 137063_3286_1457; 089131_1944_0995; 274394_3116_3127; 169256_4061_0707; 076064_3096_1329; 136352_3495_3862; 141638_0447_0650; 182461_3145_2886; 18383498; 244100_1061_2773; 048767_1598_1415; 115914_2763_1672; 302678_3532_0229; 236181_2293_0504; 033326_2847_0296; 076591_1310_1967; 157254_3871_0954; 067247_1062_3546; 125045_0971_1787; 084330_3989_1114; 173987_3074_2609; 147409_0539_3707; 071335_0728_2272; 133307_1011_1778; 88756316 |
Related Microarray Spots
| Platform | Direct Match | Indirect Match |
| Chip SAM3.0 (GPL3538) | A-1-2-5-5 | A-3-1-8-7 |
Primer Info
| Orientation | Name | Sequence | Length (bp) |
| Forward | M020F1031F | TTTACTAGGACGGCGACACC | 20 |
| Reverse | M020F1031R | TCAGAACGAGCAGTACCAGG | 20 |
Gradient Test of Primer
| Setup Conditions for 20µl PCR Reaction | PCR Program | ||||||||||||||||||
|
Tm values were calculated by primer3
design software. Details on their implementation can be found here. For a complete list of Tm values for all ISU mapped markers, click here.
|
24-Inbred Survey
- Setup conditions for 20µl PCR reaction: same as described above, use 60°C as Annealing Temperature.
Inbred Scores
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Score Legend
| B73 | Mo17 | I (Other Inbred) | Size | Code |
| + | + | + | B=M=I | 1 |
| + | + | + | B=M, B≠I, M≠I | 2 |
| + | + | + | B≠M≠I | 3 |
| + | + | + | B≠M, B=I, M≠I | 4 |
| + | + | + | B≠M, B≠I, M=I | 5 |
| + | + | - | B=M | 6 |
| + | + | - | B≠M | 7 |
| + | - | - | 8 | |
| + | - | + | B=I | 9 |
| + | - | + | B≠I | 10 |
| - | + | - | 11 | |
| - | + | + | M=I | 12 |
| - | + | + | M≠I | 13 |
| - | - | - | 14 | |
| - | - | + | 15 |
Intermated B73 x Mo17 (IBM) Map
IBM Map Scores
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
IBM Map Legend
| Code | |
| Missing Data or Heterozygous | 0 |
| B73 | 1 |
| Mo17 | 2 |
_01.jpg)
_02.jpg)
_03.jpg)